Tuesday 16 January 2018 photo 6/53
![]() ![]() ![]() |
Pet28a manual: >> http://vvx.cloudz.pw/download?file=pet28a+manual << (Download)
Pet28a manual: >> http://vvx.cloudz.pw/read?file=pet28a+manual << (Read Online)
pet vector full form
pet vector wiki
pet vector sequence
pet expression vectors
pet system manual 12th
pet vector list
pet vector map
pet28a kanamycin concentration
Alt Name: pET28a. Analyze: Sequence. Plasmid Type: Bacterial Expression. Expression Level: High. Cloning Method: Unknown. Size: 5369. 5' Sequencing 1 Primer: T7 Fwd. 5' Sequencing 1 Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'. Tag 1: His (Nterm and Cterm). Bacterial Resistance: Kanamycin. Notes:.
United States/Canada. 800.662.2566. Asia Pacific. +1.650.919.7300. Europe. +33.(0)1.3904.6880. Japan. +81.(0)77.543.6116. Clontech Laboratories, Inc. pET Express & Purify. Kits User Manual. PT5018-1 (PR153854). Cat. No(s). 631428, 631429, 631430, 631431, 631432 & 631433. Published 6/1/2011
Enzymes that do not cut pET28a(+): AatII. AflII. AgeI. AscI. AvrII. BaeI. BsaI. BseRI. BspMI. BsrGI. Bsu36I. DraI. Eam1105I FseI. KpnI. MscI. MunI. NspV. PacI. PmeI. PmlI. PstI. RleAI. RsrII. SacII. ScaI. SexAI. SfiI. SnaBI. SpeI. SrfI. Sse8387I StuI. SunI. SwaI. pET-28a(+) Restriction Sites. Novagen • FAX 608-238-1388 • E-MAIL
The Novagen pET-28a-c(+) vectors carry an N-terminal His. pET-28a(+) DNA - Novagen MSDS (material safety data sheet) or SDS, CoA and CoQ, dossiers, brochures and other available documents. The pET-28a-c(+) vectors carry an N-terminal His.
??. 1. I. ?????????. 4. A. ??. 4. B. ??????????????. 4. C. ????????. 4. D. pET???????. 5. ??????????. 5. ?????????. 6. ????. 6. pET???????. 8. E. pET?????????????????. 9. ????????????????. 9. ??????????????????
Ireland Toll Free 1800 409445 techservice@merckbiosciences.de www.novagen.com techservice@merckbiosciences.co.uk novatech@novagen.com. Novagen • pET System Manual • 11th Edition. I. ABOUT THE SYSTEM. C. System Components. pET Expression Systems provide the core reagents needed for target gene
User Manual. Champion. ™. pET SUMO Protein. Expression System. For high-level expression and enhanced solubility of recombinant proteins in E. coli and cleavage of native protein. Catalog no. K300-01. Rev. Date: 18 June 2010. Manual part no. 25-0709. MAN0000440
pET System Vectors and Hosts. Instruction Manual. Catalog #211521, #211523, #211621, #211623. Revision C0. For Research Use Only. Not for use in diagnostic procedures. 211521-12
pET System Manual. TB055 10th Edition Rev.B 0403. 1. United States & Canada. 800-207-0144. Germany. 0800 6931 000. United Kingdom. 0800 622935. Or your local sales office www.novagen.com. Novagen. This second printing of the 10 th edition of the pET Manual was published May, 2003. Novagen is continually
Annons