Previous photoThursday 22 March 2018 photo 14/43
|
pentr sd d topo sequence
=========> Download Link http://dlods.ru/49?keyword=pentr-sd-d-topo-sequence&charset=utf-8
= = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = = =
Blunt-end PCR products clone directionally into the pENTR™/SD/D-TOPO® entry vector at greater than 90% efficiency, and include an upstream Shine-Dalgarno sequence for expression in prokaryotes. For pENTR TOPO vectors, using 1-5 ng of a 1 kb PCR product or 5-10 ng of a 2 kb PCR product in a TOPO cloning reaction generally results in a suitable number of colonies.. The 4 nucleotides, CACC, base pair with the overhang sequence, GTGG, in the Directional TOPO vector. pages 8–9 for diagrams of the TOPO® Cloning site for pENTR™/D-TOPO®,. pENTR™/SD/D-TOPO®, and pENTR™/TEV/D-TOPO®.) • To enable directional cloning, the forward PCR primer must contain the sequence, CACC, at the 5′ end of the primer. The 4 nucleotides, CACC, base pair with the overhang sequence,. Description. Blunt-end PCR products clone directionally into pENTR™/SD/D-TOPO™ entry vector at greater than 90% efficiency, and include upstream Shine-Dalgarno sequence for expression in prokaryotes; Rapidly shuttle cloned genes between multiple vector systems; Reliable performance; For access to Gateway. Description. Blunt-end PCR products clone directionally into pENTR/SD/D-TOPO entry vector at greater than 90% efficiency, and include an upstream Shine-Dalgarno sequence for expression in prokaryotes; Rapidly shuttle cloned genes between multiple vector systems; Reliable performance; Directional cloning vector for. pENTR/SD/D TOPO. Full length: 2601 bp. Composition: 654 A; 623 C; 640 G; 684 T; 0 OTHER Percentage: 25% A; 24% C; 25% G; 26% T; 0%OTHER Molecular Weight (kDa): ssDNA: 803.25 dsDNA: 1603.5. ORIGIN 1 CTTTCCTGCG TTATCCCCTG ATTCTGTGGA TAACCGTATT ACCGCCTTTG AGTGAGCTGA Aliases, PENTR/SD/D-TOPO. Description, Gateway(TM) Directional TOPO(TM) entry vector. Features attL recombination sites for efficient recombination with a Gateway(TM) destination vector, universal M13 sites to facilitate sequencing, pUC-based ori for high plasmid yields, a gene 10 sequence and a. Blunt-end PCR products clone directionally into the pENTR /SD/D-TOPO entry vector at greater than 90% efficiency, and include an upstream Shine-Dalgarno sequence for expression in prokaryotes. The kit comes with everything necessary to clone and select your PCR amplified gene of interest: Gateway. Synonyms: pENTR-D-TOPO. Type: bacterial plasmid. Form: dsDNA. Size (bp)::, 2580. Properties: Gateway, TOPO Cloning, donor (entry), recombinational cloning. Vector Map: pENTR_D-TOPO-map.pdf. Vector Sequence: pENTR_D-TOPO-seq.doc. Comments: Additional information about this vector is available from the. Buy or compare Invitrogen pENTR™/SD/D-TOPO® Cloning Kit, with One Shot® Mach1™-T1 Chemically Competent E. coli(K263520) ✓ FreeShipping on all. into the pENTR™/SD/D-TOPO® entry vector at greater than 90% efficiency, and include an upstream Shine-Dalgarno sequence for expression in prokaryotes. Includes: pENTR/TEV/D-TOPO vector, dNTPs, salt solution, sterile water, universal M13 sequencing primers, OneShot MachI T1 Phage resistant Chemically E.. to Gateway System, PCR amplify gene of interest and add product straight to provided topoisomerase charged pENTR/SD/D-TOPO vector, incubate 5 minutes,. pENTR™/SD/D-TOPO®, and pENTR™/TEV/D-TOPO®. • To enable directional cloning, the forward PCR primer must contain the sequence, CACC, at the 5′ end of the primer. The 4 nucleotides, CACC, base pair with the overhang sequence, GTGG, in each pENTR™ TOPO® vector. • If you plan to express. lenght of my inserts vary from 450 to 1.5 kb. all amplification primers have CACC at 5' of forward primer. after topo reaction(followed as instructed in manual) got colonies. when i did colony PCR for almost every type of insert, every colony is positive. when i isolate plasmid and give it for sequencing, surprisingly no insert at. ... Spectinomycin selection Directional TOPO Cloning pENTR/D-TOPO Directional Cloning into Gateway; kanamycin selection pENTR/SD/D-TOPO Directional Cloning into Gateway; Shine-Delgarno, kanamycin selection; M13 sequencing primers pENTR/TEV/D-TOPO Directional Cloning into Gateway; kanamycin selection;. Blunt-end PCR products clone directionally into the pENTR/SD/D-TOPO en. DyNA Vector Map. Powered by LabGenius. Synonyms: pENTR-D-TOPO. MwoI (1956) pUC ori ApaLI (2260) MwoI (2528) attL1 ApaI (567) AflII (554) M13 F NheI (505) HindII (501) rrnB txn term rrnB trxn term NheI (239) MwoI (213) MwoI (129) MwoI. View the sequence with features on line pENTR/SD/D-TOPO Vendor:Invitrogen Vector Type: Entry Vector Backbone size: 2601. Bacteria Resistance: Kanamycin Catalog Number: K2420-20. Comments:Contains a T7 gene 10 translational enhancer and a ribosonal binding site (RBS) for optimal expression of native protein. Primer Name. Sequence (from 5' to 3'). Used for. FL-Fwd. CACCATGAGCACGTACCTACAGAGCAG. FL- and N-PYM cloning in pENTR/SD/D-TOPO vector. FL-Rvs. TGAGCGCGGCGTGCTC. FL- and C-PYM cloning in pENTR/SD/D-TOPO vector. DN-Fwd. CACCATGTGTCCCCTGCTGGC. DN- and M-PYM cloning in. sequence. •. If you plan to express your PCR product in prokaryotic cells without an N-terminal fusion tag (following recombination of the entry clone with a Gateway® destination vector), you should TOPO® Clone your PCR product into pENTR™/SD/D-TOPO®. pENTR™/SD/D-TOPO® contains a T7 gene 10 translational. I've got a problem with Invitrogen's pENTR D TOPO cloning kit. My problem = I can't. D) Colonies are then chosen, cultured, and then the plasmid DNA is purified and sequenced. The sequencing data reveals that the E. Coli were transformed with the D-TOPO plasmid not containing the PCR amplicon. With TOPO® Cloning. Technology You Can: • Clone Taq-amplified, blunt-end, and long. PCR products. • Sequence or clone directly into an expression vector.... gene 10 RBS. pENTR/SD/D-TOPO®. pENTR/D-TOPO®. CCC TT. GGG AAG TGG. AAG GGT. TTC CCA. 2.6 kb. Figure 20 - pcDNA/GW/D-TOPO® expression. The table below lists the sequence of the M13 Sequencing Primers included in the kit.. K2400-500. 20 reactions. K2420-20. 480 reactions. K2420-480. pENTR/SD/D-TOPO® Cloning Kit. 500 reactions. K2420-500. pENTR™1A. 10 µg. 11813-011... The pENTR/D-TOPO® and pENTR/SD/D-TOPO® vectors allow rapid. Strain/plasmid. Relevant Characteristic. Source. P. syringae pv. tomato DC3000 Wild-type. (1). pENTR/SD/D. Topo cloning Gateway entry vector. Invitrogen. pBS46. PnptII::gateway expression vector. (3). pBB30. pENTR/SD/D::PSPTO_0444(3' end contains FLAG coding sequence). This work. pBB28. del plasmide pENTR/SD/D-TOPO. CACC facilitate directional incorporation into the pENTR/D-TOPO vector (obtained from Invitrogen). topoisomerase molecules (TOPO) catalyze ligation of target and vector sequences. Once flanked by attL recombination sites, the sequence can be recombined with attR sites using the LR. Phylogenetic tree of the deduced amino acid sequences of the two LusPLA2s with known orthologous genes. Figure S2: LusPLA2I in pENTR/SD/D/TOPO generated by gateway cloning. (a) Vector map of LusPLA2I in. Vector map of pET301/CT-DEST harbouring LusPLA2II-6xHis destination clone. (b). Confirmation of. ... This study pPS2745 Kmr; Nested PCR with primers 2015 +2016, then 2155 +2156 for 1,051 bp fragment, cloned into pENTR-SD-D-TOPO This study pPS2746. LR recombination reaction with pPS2737 +pPS2747 This study PLASMIDS FOR ENGINEERING OFTAT-SIGNAL SEQUENCE MUTATIONS pPS2674 Apr Kmr;. A point mutation in mobA prevent self-mobilization. pCVD006 / CV-cat_A7120: The device confers chloramphenicol (Cm) resistance. pCVD030 / CV-PconII-LTRBS-GFPmut2: Promoter/reporter device where GFPmut2 is driven by a PconII promoter. The RBS and flanking sequences are from the pENTR/SD/D-Topo vector. was amplified (see Table S4 for primer sequences) and cloned into the pGEM-T. cloned into pENTR-D Topo or pENTR-SD-D Topo (Invitro- gen).. a 2,271 bp genomic sequence, preceding the LjCYCLOPS tran- scription start site and containing the promoter. Primer sequences are listed in Table S4. Gene ID, LOC_Os08g41320. transcript. Vector, pENTR/SD/D-TOPO. Note. Request Information: Deposited to ABRC. 5' Primer Name: 3' Primer Name: R220DN. 5' Primer Tm (º C):, 67.2, 3' Primer Tm (º C):, 64.8. 5' Primer Sequence: caccatggacggcggcagggtc, 3' Primer Sequence: gaactccattttcatgtggcctgcttgctgc. Species, Maize. TF Family, LIM. Gene ID, GRMZM2G017845. transcript, T01. Vector, pENTR/SD/D-TOPO. Note. Request Information: Deposited to ABRC. 5' Primer Name: 3' Primer Name: 5' Primer Tm (º C):, 3' Primer Tm (º C):. 5' Primer Sequence: 3' Primer Sequence: PCR Condition: Nucleotide Sequence. Species, Maize. TF Family, LIM. Gene ID, GRMZM2G099328. transcript, T01. Vector, pENTR/SD/D-TOPO. Note. Request Information: Deposited to ABRC. 5' Primer Name: 3' Primer Name: 5' Primer Tm (º C):, 3' Primer Tm (º C):. 5' Primer Sequence: 3' Primer Sequence: PCR Condition: Nucleotide Sequence. Species, Maize. TF Family, MYB. Gene ID, GRMZM2G139284. transcript, T01. Vector, pENTR/SD/D-TOPO. Note. Request Information: Deposited to ABRC. 5' Primer Name: 3' Primer Name: 5' Primer Tm (º C):, 3' Primer Tm (º C):. 5' Primer Sequence: 3' Primer Sequence: PCR Condition: Nucleotide Sequence. Species, Maize. TF Family, BSD. Gene ID, GRMZM2G145594. transcript, T01. Vector, pENTR/SD/D-TOPO. Note. Request Information: Deposited to ABRC. 5' Primer Name: 3' Primer Name: 5' Primer Tm (º C):, 3' Primer Tm (º C):. 5' Primer Sequence: 3' Primer Sequence: PCR Condition: Nucleotide Sequence. Species, Maize. TF Family, PLATZ. Gene ID, GRMZM2G017882. transcript, T01. Vector, pENTR/SD/D-TOPO. Note. Request Information: Deposited to ABRC. 5' Primer Name: 3' Primer Name: 5' Primer Tm (º C):, 3' Primer Tm (º C):. 5' Primer Sequence: 3' Primer Sequence: PCR Condition: Nucleotide Sequence. Species, Maize. TF Family, MYB. Gene ID, GRMZM2G015021. transcript, T01. Vector, pENTR/SD/D-TOPO. Note. Request Information: Deposited to ABRC. 5' Primer Name: 3' Primer Name: 5' Primer Tm (º C):, 3' Primer Tm (º C):. 5' Primer Sequence: 3' Primer Sequence: PCR Condition: Nucleotide Sequence. Species, Maize. TF Family, ARR-B. Gene ID, GRMZM2G126834. transcript, T01. Vector, pENTR/SD/D-TOPO. Note. Request Information: Deposited to ABRC. 5' Primer Name: 3' Primer Name: 5' Primer Tm (º C):, 3' Primer Tm (º C):. 5' Primer Sequence: 3' Primer Sequence: PCR Condition: Nucleotide Sequence. I used pENTR/SD/D-TOPO, I can't get sequence read longer than 200bp(most of them is 50bp). then later when I check they all don't contain any insert. only positive was having 1kb insert. Yes, I was too optimistic in first try of TOPO cloning based on manual. Delete. Reply. Anonymous June 24, 2011 at. vector pENTR/SD/D-TOPO. After confirmation by DNA sequencing, the genes were transferred to expression vectors (pGG-DEST and. pDEST15, respectively). The putative B. japonicum diterpene synthases were character- ized using a previously described modular metabolic engineering system to. TIP1 C401A was created by site-directed mutagenesis using the Quikchange II kit (Stratagene) on the epitope-tagged TIP1 cDNA described above in pENTR/SD/D-TOPO before being recombined into pYES DEST-52. AKR1 controls were introduced in pPB575, a 2-μ autonomous replication sequence origin of replication,. crosses, and the homozygous lines were confirmed by genotyping. To further examine the regulation of ethylene on PIF3 promoter in Figure 2H, about 3kb of the sequence upstream of the ATG of PIF3 was PCR amplified from Col-0 genomic DNA. The PCR product was cloned into pENTR/SD/D-TOPO vectors (Invitrogen). 1998). To generate the pENTR™/SD/D-TOPO® vector for facilitating the generation of C- or N-terminal in-frame MKKK18 fusions, cDNA for MKKK18 was amplified using Pfu polymerase, cloned into pENTR and then sequenced. To generate the recombinant GST- or His-tagged vectors, the pENTR-MKKK18. Supplemental Figure 12. LEA11 and LEA12 sequence alignment. Sequences were aligned using the. MultAlin software (http://multalin.toulouse.inra.fr/multalin/) using default parameters.... pENTR/SD/D-TOPO (+CDS). MPIMP. 3. At1g03120. cDNA Arabidopsis seeds. MPIMP. 4. At1g20440. pENTR/SD/D-TOPO (+CDS). amplification and directional topoisomerization insertion into pENTR/SD/D-TOPO, with the ensuing constructs verified by complete gene sequencing. These clones were subsequently transferred via directional recombination into the DEST cassette of a previously described. pGG-DEST vector (19). Recombinant expression. The MIK2 coding sequence was amplified from Col-0 cDNA using the primers 5'-CACCATGAACAAAACAAACCCAG-3' and 5'-AGAAAAGGCAGTGGAGATAGAGAGC-3'. .. The corresponding amplicon was cloned into pENTR/D-TOPO using the pENTR Directional TOPO Cloning Kit (Invitrogen, CA, USA). .. The insert was. Amplification, cloning, and sequencing were performed in the same manner as described above. Other plasmid and mutant constructions. DC3000 hopAA1-1 with its native promoter was cloned into. pENTR/SD/D-TOPO. Amplification of 216 basepairs upstream of the hopAA1-1 start codon to the 3′ end of the gene lacking. PCR products were cloned into pENTR/SD/D/TOPO vector (Invitrogen) and resulting entry clones were confirmed by sequencing for carrying targeted mutations and no PCR error. To make maltose-binding protein (MBP)-tagged CCaMK variants, insert sequences of the entry clones were converted into the pKM596 vector. Entry vector containingcandidate hrp promoter upstream from noted gene/Kan R This study HLN102 pENTR/SD/D-TOPO::P PSPTO_5053 ; Entry vector containingcandidate hrp promoter. Given this database and a protein sequence query, PaperBLAST uses protein-protein BLAST to find similar sequences with E < 0.001. a) a biotinylation signal sequence b) a linker sequence c) a cysteine to serine mutation in the N terminal region of C3d d) Sca1 and BamH1 restriction enzyme cut sites was amplified by PCR (using a bovine C3d construct prepared in a previous project, as template), and ligated into the plasmid pENTR/SD/D-TOPO. PCR fragments were cloned into pENTR/SD/D by directional TOPO cloning and were subsequently used to generate the gfp reporter constructs by LR reaction with the pHL1 destination vector (Table 1) using LR Clonase II enzyme mix. (Invitrogen). All constructs were confirmed by sequencing. Plasmids. RNA had antisense complementarity to a repeated sequence element in 3‟ untranslated region (UTR) of the.. endogenous transcription and insertion of the repeated transgene sequence into the genome can bring out the... pENTR/SD/D-TOPO,PCR Product of AtmiRNA840 (Primi Expression. pEG101). The complete coding sequence of the AtCRF5 gene (At2g46310) from A. thaliana lacking the stop-codon was cloned into the plasmid pENTR/SD/D Topo (Invitrogen). Six larger deletions of about 50 bp across the protein were introduced into the coding sequence of AtCRF5 by PCR amplification of the. Contain an ATG initiation codon and a Shine-Dalgarno sequence (RBS) with optimal spacing for proper translation initiation in E. coli (Shine and. Dalgarno, 1975). Note: If you clone your gene of interest into an entry vector that supplies a Shine-. Dalgarno RBS (e.g. pENTR/SD/D-TOPO® or pENTR™11), then your gene of. Christopher Parker christopher.parker09@imperial.ac.uk. Leukocyte Biology Section,. Faculty of Medicine,. Sir Alexander Fleming Building,. Imperial College London,. London, SW7 2AZ. Thesis for Masters of Research in Biomedical Research. August 2010. Supervisor: Dr James Pease. Words 4,988. Page 2. Abstract. In Brassica napus, a tentative consensus sequence (TC11332) was assembled from ESTs (http://compbio.dfci.harvard.edu/tgi/plant.html) that appeared to encode a homolog of... The fragments were introduced into the Gateway entry vector pENTR/SD/d-TOPO (Invitrogen) to produce pENTR/MEB1 and pENTR/MEB2. A binary vector for STR and STR2 co-overexpression analysis, the cDNA sequences of STR (XM_003631084, 2,454bp) and STR2 (XM_003612901, 2,184bp) were amplified by PCR and cloned into pENTR/SD/D-Topo and pDNOR-p4p3. (Invitrogen), respectively. These two fragments were then transferred. RefSeq, NCBI Reference Sequence Project; SPHK, sphingosine kinase;. accession numbers NP_068807 (in the NCBI Reference Sequence Pro-. (15)) was obtained using 5-CACCATGGGGGCGACGGGGGCGGCG and 5-TCAGCTGTGTGAGTCT G GCTTCG and cloned in pENTR/S.D./. D-TOPO. (www.invitrogen.com) or contact Technical Service (see page 28). Vector. Catalog no. pENTR/D-TOPO®. K2400-20. pENTR/SD/D-TOPO®. K2420-20. pENTR™... Sequencing. To confirm that your gene of interest is in frame with the appropriate tags, you may want to sequence your expression construct. Nevertheless, sequence comparisons also suggest potential homology between diterpene synthases from bacteria, plants, and fungi... gel electrophoresis (Qiaquick Gel Extraction Kit, Qiagen) and cloned into the Gateway system vector pENTR/SD/D-TOPO using a topoisomerase-mediated procedure. Gateway cloning (Invitrogen, USA); Donor vector - pENTR™/SD/D-TOPO®, (Invitrogen, USA); Destination vector- pANIC 6A,. University of Tennessee. Minipreparation of overnight cultures; Restriction using EcoRV – cleaves the pANIC 6A vector once (16937) and ask2 sequence once (1517). Sequencing; Future steps:. Glycoprotein D (gD) of BHV-1 represents a major component of the viral envelope and is a dominant immunogen. gD encoding. cloning into pENTR/SD/D Directional TOPO vector to produce entry clone. Recombinant plasmids.. sequence (ATG) and kozak sequence were two important features of the forward primer.
Annons
Visa toppen
Show footer