Thursday 5 April 2018 photo 9/15
|
Pet28a manual: >> http://lzb.cloudz.pw/download?file=pet28a+manual << (Download)
Pet28a manual: >> http://lzb.cloudz.pw/read?file=pet28a+manual << (Read Online)
United States/Canada. 800.662.2566. Asia Pacific. +1.650.919.7300. Europe. +33.(0)1.3904.6880. Japan. +81.(0)77.543.6116. Clontech Laboratories, Inc. pET Express & Purify. Kits User Manual. PT5018-1 (PR153854). Cat. No(s). 631428, 631429, 631430, 631431, 631432 & 631433. Published 6/1/2011
pET vectors plus host strains with induction control Find MSDS or SDS, a COA, data sheets and more information.
Name: pET28a. Description: Bacterial expression vector with T7lac promoter, adds N-terminal His tag, thrombin cleavage site, internal T7 epitope tag, C-terminal His tag; kanamycin resistance; restriction enzyme cloning. Synonyms: pET28, pET-28a. Type: bacterial plasmid. Form: dsDNA. Size (bp)::, 0. Properties: bacterial
Page 1. Nco l. Xba l. T7 terminator. pET-28a(+). 5.4kb. Lac l. KanR. pB. R. 322 Ori f1 O ri. Blp l. Bgl ll. Thrombin. His tag. RBS. Xho l. Not l. Hind lll. Sal l. Sac l. EcoR l. BamH l. Nde l. Nhe l. T7 tag. His tag. T7 promoter lac O. MCS.
The Novagen pET-28a-c(+) vectors carry an N-terminal His•Tag/thrombin/T7•Tag configuration plus an optional C-terminal His•Tag sequence. Find MSDS or SDS, a COA, data sheets and more information.
Ireland Toll Free 1800 409445 techservice@merckbiosciences.de www.novagen.com techservice@merckbiosciences.co.uk novatech@novagen.com. Novagen • pET System Manual • 11th Edition. I. ABOUT THE SYSTEM. C. System Components. pET Expression Systems provide the core reagents needed for target gene
Page 1. Page 2.
pET System Manual. 2. TB055 10th Edition Rev. B 0403. United States & Canada. 800-207-0144. Germany. 0800 6931 000. United Kingdom. 0800 622935. Or your local sales office www.novagen.com. Novagen. Colony PCR for transcription/translation analysis. 31. Colony screening. 32. Plasmid preparation procedure.
pET System Vectors and Hosts. Instruction Manual. Catalog #211521, #211523, #211621, #211623. Revision C0. For Research Use Only. Not for use in diagnostic procedures. 211521-12
Alt Name: pET28a. Analyze: Sequence. Plasmid Type: Bacterial Expression. Expression Level: High. Cloning Method: Unknown. Size: 5369. 5' Sequencing 1 Primer: T7 Fwd. 5' Sequencing 1 Primer Sequence: 5'd[TAATACGACTCACTATAGGG]3'. Tag 1: His (Nterm and Cterm). Bacterial Resistance: Kanamycin. Notes:.
Annons


Visa toppen
Show footer